pet28 mhl (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
pet28 mhl
Pet28 Mhl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet28+mhl/pET28-MHL+(Plasmid+%2326096)/pm41484378-285-37-38
Average 94 stars, based on 39 article reviews
Pet28 Mhl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet28+mhl/pET28-MHL+(Plasmid+%2326096)/pm41484378-285-37-38
Average 94 stars, based on 39 article reviews
pet28 mhl - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
Ubiquitin Proteomics:Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040 , P0CG48 ) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077 ) was cloned into Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway. Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and purification The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077) was cloned into Article Title: Zinc-mediated regulation of TMEM106B function in the endolysosomal pathway revealed through the systematic identification of TRIM2/3 ubiquitination substrates Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and puri cation The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the genes encoding human TRIM3 and UBE2D3 (IDs: O75382, P61077) were cloned into Clone Assay:Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040 , P0CG48 ) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077 ) was cloned into Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway. Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and purification The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077) was cloned into Article Title: Zinc-mediated regulation of TMEM106B function in the endolysosomal pathway revealed through the systematic identification of TRIM2/3 ubiquitination substrates Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and puri cation The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the genes encoding human TRIM3 and UBE2D3 (IDs: O75382, P61077) were cloned into Expressing:Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040 , P0CG48 ) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077 ) was cloned into Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway. Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and purification The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077) was cloned into Article Title: Zinc-mediated regulation of TMEM106B function in the endolysosomal pathway revealed through the systematic identification of TRIM2/3 ubiquitination substrates Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and puri cation The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the genes encoding human TRIM3 and UBE2D3 (IDs: O75382, P61077) were cloned into Article Title: ERK1/2 interaction with DHPS regulates eIF5A deoxyhypusination independently of ERK kinase activity. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat#11140050 Fetal Bovine Serum Thermo Fisher Scientific Cat#16000044 HyClone Bovine Growth Serum Cytiva Cat#SH30541.03 PierceTM Anti-HA Agarose Thermo Fisher Scientific Cat#26181 Ni Sepharose High Performance Cytiva Cat#17526801 Protein G PLUS-Agarose Santa Cruz Biotechnology Cat#sc-2002 BS3 (bis(sulfosuccinimidyl)suberate) Thermo Fisher Scientific Cat#21580 Deposited data Molecular model of DHS-ERK2 complex with 1:1 stoichiometry This study PDB: 8PVU Cryo-EM map of DHS-ERK2 complex with 1:1 stoichiometry refined in C1 symmetry This study EMDB: EMD-17972 Cryo-EM map of the third of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C1 symmetry This study EMDB: EMD-17977 Cryo-EM map of the third of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C2 symmetry This study EMDB: EMD-17978 Cryo-EM map of the first of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C1 symmetry This study EMDB: EMD-17983 Cryo-EM map of the first of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C2 symmetry This study EMDB: EMD-17984 Cryo-EM map of the second of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C1 symmetry This study EMDB: EMD-17981 Cryo-EM map of the second of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C2 symmetry This study EMDB: EMD-17982 Cryo-EM map of DHS-ERK2 complex with 1:3 stoichiometry refined in C1 symmetry This study EMDB: EMD-17985 Cryo-EM map of DHS-ERK2 complex with 1:4 stoichiometry refined in C1 symmetry This study EMDB: EMD-17986 Cryo-EM map of DHS-ERK2 complex with 1:4 stoichiometry refined in D2 symmetry This study EMDB: EMD-17987 TAP-MS raw data This study MassIVE: MSV000088047 Experimental models: Cell lines HEK293 American Type Culture Collection CRL-1573TM 293T American Type Culture Collection CRL-3216TM LNCaP American Type Culture Collection CRL-1740TM A375 American Type Culture Collection CRL-1619TM Mia-PaCa-2 American Type Culture Collection CRL-1420TM HeLa American Type Culture Collection CCL-2TM HEK293-DRaf:ER Hong et al., 2009 N/A LNCaP-DRaf:ER Hong et al., 2018 N/A Oligonucleotides RT-PCR forward primer for eIF5A: GCGGCCGCACCATGGCAGATG ACTTGGACTTCG This study N/A (Continued on next page) Cell Reports 43, 114831, October 22, 2024 19 .. N/A N/A Recombinant DNA Full-length human deoxyhypusine synthase with N-teminal 6xHis-tag followed by TEV cleavage site in pET-24d(+) for bacterial expression Genescript N/A Human eukaryotic translation initiation factor 5A-1 (residues 15–151) with N-teminal 6xHis-tag followed by TEV cleavage site in Article Title: ERK1/2 interaction with DHPS regulates eIF5A deoxyhypusination independently of ERK kinase activity Article Snippet: Full-length human deoxyhypusine synthase with N-teminal 6xHis-tag followed by TEV cleavage site in pET-24d(+) for bacterial expression , Genescript , N/A. .. Human eukaryotic translation initiation factor 5A-1 (residues 15–151) with Plasmid Preparation:Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040 , P0CG48 ) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077 ) was cloned into Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway. Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and purification The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077) was cloned into Article Title: Zinc-mediated regulation of TMEM106B function in the endolysosomal pathway revealed through the systematic identification of TRIM2/3 ubiquitination substrates Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and puri cation The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the genes encoding human TRIM3 and UBE2D3 (IDs: O75382, P61077) were cloned into Article Title: Molecular basis for recognition of Gly/N-degrons by CRL2 ZYG11B and CRL2 ZER1 . Article Snippet: .. The coding sequences of GFQRGK or FLHVGQ were appended to the N terminus of GST, and constructed into Article Title: Molecular Analysis of Membrane Targeting by the C2 Domain of the E3 Ubiquitin Ligase Smurf1 Article Snippet: .. Enhanced green fluorescent protein (EGFP)-Smurf1 C2 and mCherry–Smurf1 C2 were constructed by transferring the Smurf1 C2 gene from Generated:Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040 , P0CG48 ) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077 ) was cloned into Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway. Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and purification The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077) was cloned into Article Title: Zinc-mediated regulation of TMEM106B function in the endolysosomal pathway revealed through the systematic identification of TRIM2/3 ubiquitination substrates Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and puri cation The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the genes encoding human TRIM3 and UBE2D3 (IDs: O75382, P61077) were cloned into Recombinant:Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway. Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and purification The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077) was cloned into Article Title: Zinc-mediated regulation of TMEM106B function in the endolysosomal pathway revealed through the systematic identification of TRIM2/3 ubiquitination substrates Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and puri cation The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the genes encoding human TRIM3 and UBE2D3 (IDs: O75382, P61077) were cloned into Article Title: ERK1/2 interaction with DHPS regulates eIF5A deoxyhypusination independently of ERK kinase activity. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat#11140050 Fetal Bovine Serum Thermo Fisher Scientific Cat#16000044 HyClone Bovine Growth Serum Cytiva Cat#SH30541.03 PierceTM Anti-HA Agarose Thermo Fisher Scientific Cat#26181 Ni Sepharose High Performance Cytiva Cat#17526801 Protein G PLUS-Agarose Santa Cruz Biotechnology Cat#sc-2002 BS3 (bis(sulfosuccinimidyl)suberate) Thermo Fisher Scientific Cat#21580 Deposited data Molecular model of DHS-ERK2 complex with 1:1 stoichiometry This study PDB: 8PVU Cryo-EM map of DHS-ERK2 complex with 1:1 stoichiometry refined in C1 symmetry This study EMDB: EMD-17972 Cryo-EM map of the third of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C1 symmetry This study EMDB: EMD-17977 Cryo-EM map of the third of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C2 symmetry This study EMDB: EMD-17978 Cryo-EM map of the first of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C1 symmetry This study EMDB: EMD-17983 Cryo-EM map of the first of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C2 symmetry This study EMDB: EMD-17984 Cryo-EM map of the second of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C1 symmetry This study EMDB: EMD-17981 Cryo-EM map of the second of three possible DHS-ERK2 complexes with 1:2 stoichiometry refined in C2 symmetry This study EMDB: EMD-17982 Cryo-EM map of DHS-ERK2 complex with 1:3 stoichiometry refined in C1 symmetry This study EMDB: EMD-17985 Cryo-EM map of DHS-ERK2 complex with 1:4 stoichiometry refined in C1 symmetry This study EMDB: EMD-17986 Cryo-EM map of DHS-ERK2 complex with 1:4 stoichiometry refined in D2 symmetry This study EMDB: EMD-17987 TAP-MS raw data This study MassIVE: MSV000088047 Experimental models: Cell lines HEK293 American Type Culture Collection CRL-1573TM 293T American Type Culture Collection CRL-3216TM LNCaP American Type Culture Collection CRL-1740TM A375 American Type Culture Collection CRL-1619TM Mia-PaCa-2 American Type Culture Collection CRL-1420TM HeLa American Type Culture Collection CCL-2TM HEK293-DRaf:ER Hong et al., 2009 N/A LNCaP-DRaf:ER Hong et al., 2018 N/A Oligonucleotides RT-PCR forward primer for eIF5A: GCGGCCGCACCATGGCAGATG ACTTGGACTTCG This study N/A (Continued on next page) Cell Reports 43, 114831, October 22, 2024 19 .. N/A N/A Recombinant DNA Full-length human deoxyhypusine synthase with N-teminal 6xHis-tag followed by TEV cleavage site in pET-24d(+) for bacterial expression Genescript N/A Human eukaryotic translation initiation factor 5A-1 (residues 15–151) with N-teminal 6xHis-tag followed by TEV cleavage site in Purification:Article Title: TRIM2 E3 ligase substrate discovery reveals zinc-mediated regulation of TMEM106B in the endolysosomal pathway. Article Snippet: In all cases, the samples were imaged using a Leica SP8 confocal microscope system with a 63x/1.4 numerical aperture oil objective using lasers at wavelengths of 405, 488, 552, and/or 638 nm. .. Recombinant protein expression and purification The genes encoding human TRIM2 and ubiquitin (NCBI gene IDs: Q9C040, P0CG48) were cloned into the expression plasmid pETM11 (generated at EMBL); while the gene encoding UBE2D3 (ID: P61077) was cloned into Construct:Article Title: Molecular basis for recognition of Gly/N-degrons by CRL2 ZYG11B and CRL2 ZER1 . Article Snippet: .. The coding sequences of GFQRGK or FLHVGQ were appended to the N terminus of GST, and constructed into Article Title: Molecular Analysis of Membrane Targeting by the C2 Domain of the E3 Ubiquitin Ligase Smurf1 Article Snippet: .. Enhanced green fluorescent protein (EGFP)-Smurf1 C2 and mCherry–Smurf1 C2 were constructed by transferring the Smurf1 C2 gene from other:Article Title: ERK1/2 interaction with DHPS regulates eIF5A deoxyhypusination independently of ERK kinase activity. Article Snippet: 14 N/A Full length DHPS cDNA in pCMV3-ORF-HA Sino Biological Cat#HG14407-CY pCEFL-eIF5A Clement et al.Ref. Transferring:Article Title: Molecular Analysis of Membrane Targeting by the C2 Domain of the E3 Ubiquitin Ligase Smurf1 Article Snippet: .. Enhanced green fluorescent protein (EGFP)-Smurf1 C2 and mCherry–Smurf1 C2 were constructed by transferring the Smurf1 C2 gene from |
![Patient and mutation characteristics by DNMT3A allelic state. (A) Classification of DNMT3A mutants. (B) Frequency of driver mutations per DNMT3A mutant group (SM [left] and DM [right]). The percentage in which each individual gene occurs is shown behind each bar. (C) OS of DNMT3A SM (blue line) and DNMT3A DM (green line). (D) Lollipop plot illustrating the distribution of mutations in the DNMT3A SM cohort (upper part) and DNMT3A DM cohort (bottom part). The length of a lollipop represents the number of patients that carry a mutation at a specific amino acid. Each point is colored by the mutation type of the most frequent occurring mutation at that specific location. (E) Combination of type of mutations in DNMT3A DMs with heterozygous mutations. SNV, single nucleotide variant.](https://pub-med-central-images-cdn.bioz.com/pub_med_central_ids_ending_with_4108/pmc11954108/pmc11954108__BLOODA_ADV-2024-014698-gr4.jpg)
